View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15231_low_45 (Length: 230)
Name: NF15231_low_45
Description: NF15231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15231_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 23 - 216
Target Start/End: Complemental strand, 16645213 - 16645030
Alignment:
| Q |
23 |
ggaattagagagtgatacagtgaccaaaaggatcattcgtgacaacataatttcaaatggtgaaacagctcaagctcctaatgatgtattggctttctct |
122 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16645213 |
ggaattagagaatgacacagtgaccaaaaggatcattcgtgacaacataatttcaaatggtgaaacagctcaagctcctaatgatgtattggctttctct |
16645114 |
T |
 |
| Q |
123 |
cgatcagttcataaagttgattcctcactcgaatgatccatgtatttttattaaattttgtgataaacaaatttgtaatgaatttcattgtttt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16645113 |
cgatcagttcataaagttgattcctcactcgaatgattcatgtat----------ttttgtgataaacaaatttgtaatgaatttcactgtttt |
16645030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University