View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15232_high_9 (Length: 365)
Name: NF15232_high_9
Description: NF15232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15232_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 19 - 323
Target Start/End: Original strand, 14420078 - 14420384
Alignment:
| Q |
19 |
tttttggactgtccattctcataa--cannnnnnngctttgattttctcttatttgcagaaaagaaacacaagtgggtgataattattggtatcttagtg |
116 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14420078 |
tttttggactgtccattctcataaaacatttttttgctttgattttctcttatttgcagaaaagaaacacaagtgggtgataattattggtatcttagtg |
14420177 |
T |
|
| Q |
117 |
agtgtgacattgctttcagtaattaccttgatcattttcattctaaggagaaataaagcctatgaaaccagcaaatatgatccaaaaactgtctctaaaa |
216 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14420178 |
agtgtgacattgctttccgtaattaccttgatcattttcattctaaggagaaataaagcctatgaaaccagcaaatatgatccaaaaactgtctctaaaa |
14420277 |
T |
|
| Q |
217 |
gatcatttggcaatagaactatttccttaaggaatcatgagtttcataaagaatatatggaaggtaacttatatagaaatttatggtctgtttggtttaa |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14420278 |
gatcatttggcaatagaactatttccttaaggaatcatgagtttcataaagaatatatggaaggtaacttatatagaaatttaaggtctgtttggtttaa |
14420377 |
T |
|
| Q |
317 |
gaaaatg |
323 |
Q |
| |
|
||||||| |
|
|
| T |
14420378 |
gaaaatg |
14420384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University