View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15233_low_3 (Length: 347)
Name: NF15233_low_3
Description: NF15233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15233_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 18 - 329
Target Start/End: Complemental strand, 49266588 - 49266273
Alignment:
| Q |
18 |
acctatggctttgctcatttatccttatgagcttaa-gacattgccct---ctctacataatactttatcatttgtgcagagagatcaaaattgctgagt |
113 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49266588 |
acctatgggtttgctcctttatccttatgagcttcttgacattgccctgatctctacataatactttatcatttgtgcagagagatcaaaattgctgagt |
49266489 |
T |
|
| Q |
114 |
tcctcgagtcctaaggcagaattggagagtgtctcgggtcctaagacgcgtgatgaggcagaagccaatccgcgtgcacgtacattcacattacaagagc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49266488 |
tcctcgagtcctaaggcagaattggagagtgtctcgggtcctaagacgcgtgatgaggcagaagccaatccgcgtgcacatacattcacattacaagagc |
49266389 |
T |
|
| Q |
214 |
ttaaagccgcaaccaacaactttgcgccggaatgttttataggtgaagggggctttgggcctgtatacaaaggttaccttgagagcgctaaaaacgtaag |
313 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49266388 |
ttaaagccgcaaccaataactttgcgccggaatgttttataggtgaagggggctttgggcctgtatacaaaggttaccttgagagcgctaaaaacgtaag |
49266289 |
T |
|
| Q |
314 |
ttgtgatagctgttgc |
329 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
49266288 |
ttgtgatagctgttgc |
49266273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University