View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15233_low_7 (Length: 239)

Name: NF15233_low_7
Description: NF15233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15233_low_7
NF15233_low_7
[»] chr3 (2 HSPs)
chr3 (67-229)||(53147626-53147787)
chr3 (1-56)||(53147821-53147876)


Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 67 - 229
Target Start/End: Complemental strand, 53147787 - 53147626
Alignment:
67 tgatataaaacgaagcttccgtgacttttttgtgtaatgataaaatattttagggattgatatgatacggaaataaataaaaatcagtgatacgtcaaca 166  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
53147787 tgatataaaacgaagcttccgtgacttttttgtgtaatgataaaatattttagggattgatatgatacggaaataaataaaa-tcagtgatacgtcaaca 53147689  T
167 ttcctgactttctggatccctcatactttttgctatctgtagatcttgggaaacatgatgatg 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53147688 ttcctgactttctggatccctcatactttttgctatctgtagatcttgggaaacatgatgatg 53147626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 53147876 - 53147821
Alignment:
1 atttttggaagatctatgatttcgatgcccacacttaacttaaaatgcattaaaat 56  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
53147876 atttttggaagatctatgatatcgatgcccacacttaacttaaaatgcattaaaat 53147821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University