View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15233_low_7 (Length: 239)
Name: NF15233_low_7
Description: NF15233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15233_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 67 - 229
Target Start/End: Complemental strand, 53147787 - 53147626
Alignment:
| Q |
67 |
tgatataaaacgaagcttccgtgacttttttgtgtaatgataaaatattttagggattgatatgatacggaaataaataaaaatcagtgatacgtcaaca |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53147787 |
tgatataaaacgaagcttccgtgacttttttgtgtaatgataaaatattttagggattgatatgatacggaaataaataaaa-tcagtgatacgtcaaca |
53147689 |
T |
 |
| Q |
167 |
ttcctgactttctggatccctcatactttttgctatctgtagatcttgggaaacatgatgatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53147688 |
ttcctgactttctggatccctcatactttttgctatctgtagatcttgggaaacatgatgatg |
53147626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 53147876 - 53147821
Alignment:
| Q |
1 |
atttttggaagatctatgatttcgatgcccacacttaacttaaaatgcattaaaat |
56 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
53147876 |
atttttggaagatctatgatatcgatgcccacacttaacttaaaatgcattaaaat |
53147821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University