View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15234_high_4 (Length: 255)
Name: NF15234_high_4
Description: NF15234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15234_high_4 |
 | |
|
| [»] scaffold0223 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0223 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 10 - 192
Target Start/End: Original strand, 25579 - 25763
Alignment:
| Q |
10 |
agtcattttaggtgcgggacgtcaatttataccttcaaggcaaatataagcaacgagcattatttcaaattattgataattgatgcatctgatttatatt |
109 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||| |||||||||||||| |||||| ||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
25579 |
agtcattttagatgcgggacatcaatttataccttcaagacaaatataagcaacaagcattgtttcaaattattgataattgatgtatctggtttatatt |
25678 |
T |
|
| Q |
110 |
atagaccggttacaatagttattcaatgagc--nnnnnnnnnnacttatatttaagataggaggaataaaaatgaaggctttcga |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
25679 |
atagaccggttacaatagttattcaatgagcctttttctttttacttatatttaagataggaggagtaaaagtgaaggctttcga |
25763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 175 - 240
Target Start/End: Original strand, 25786 - 25851
Alignment:
| Q |
175 |
aaaaatgaaggctttcgagtatgttaataatgagagtaagaatcgaatacttaaaaggaaaatatt |
240 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
25786 |
aaaagtgaaggctttcgagtatgttaataatgagagcaagaatcgaatactttaaaggaaaatatt |
25851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University