View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15234_low_1 (Length: 445)
Name: NF15234_low_1
Description: NF15234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15234_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 7e-87; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 7e-87
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 28522587 - 28522831
Alignment:
| Q |
1 |
cctttgtcaacctacgtcctgctgtcactggtatcttgctccctcacctctttgatctattatattgctcatatgatcttcaagcttaaatatctttatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28522587 |
cctttgtcaacctacgtcctgctgtcactggtatcttgctccctcacctctttgatctattat--tgctcatatgatcttcaagcttaaatatctttatt |
28522684 |
T |
|
| Q |
101 |
aatcatcactttcctttttatcttttgcaggtcatatcctttttagtctgatgtta-------------gtagtataattaatgaacgttatgtgtatga |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||| |
|
|
| T |
28522685 |
aatcatcactttcctttttatcttttgcaggtcatatcctttttagtctgatgttaataaaaaaagttagtagtataattgatgaaccttatgtgtatga |
28522784 |
T |
|
| Q |
188 |
atattagtagattatcatttatgtataa----atttgttcaattctg |
230 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28522785 |
atattactagattatcatttatgtataaataaatttgttcaattctg |
28522831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 342 - 425
Target Start/End: Original strand, 28522948 - 28523031
Alignment:
| Q |
342 |
ggggtttagatttagagatatggtacatagtaatacataacgggtaagaatgattaatctatctttataatatggtaagtgtcg |
425 |
Q |
| |
|
|||||||| ||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28522948 |
ggggtttacatttagagatatgttccgtagtaatacataacgggtaagaatgattaatctatctttataatatggtaagtgtcg |
28523031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 242 - 277
Target Start/End: Original strand, 28522850 - 28522885
Alignment:
| Q |
242 |
atcttgcaagataattagtagtattaataagtgtgt |
277 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28522850 |
atcttgcaagataattagttgtattaataagtgtgt |
28522885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 28456601 - 28456641
Alignment:
| Q |
1 |
cctttgtcaacctacgtcctgctgtcactggtatcttgctc |
41 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
28456601 |
cctttgtcaacctgcgtcctgctgtgcctggtatcttgctc |
28456641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 113 - 145
Target Start/End: Original strand, 28456694 - 28456726
Alignment:
| Q |
113 |
cctttttatcttttgcaggtcatatccttttta |
145 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
28456694 |
ccttcttatcttttgcaggtcatatccttttta |
28456726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University