View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15234_low_6 (Length: 280)
Name: NF15234_low_6
Description: NF15234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15234_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 17 - 251
Target Start/End: Original strand, 11960310 - 11960545
Alignment:
| Q |
17 |
aaaaacttggaagtgtattttgacaacaatgctggatttgtatgtgttttcccaagagttgtttgtggtttggcagcggtggtgtgtggcgaa-tagcag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
11960310 |
aaaaacttggaagtgtattttgacaacaatgctggatttgtatgtgttttcccaagagttgtttgtggtttggcagcggtggtgtgtggcgaagtggcag |
11960409 |
T |
 |
| Q |
116 |
tggaaaaaatcttgctagtttcagggatagtcataaattcataatgatgttttggagaagattaaaggatgaagttggtggtgttaactttttagtttaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11960410 |
tggaaaaaatcttgctagtttcagggatagtcataaattcatgatgatgttttggagaagattaaaggatgaagttggtggtgttaactttttagtttaa |
11960509 |
T |
 |
| Q |
216 |
ttttaaatttccaatttttacatccctatcaaactg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11960510 |
ttttaaatttccaatttttacatccctatcaaactg |
11960545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University