View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15235_high_3 (Length: 277)
Name: NF15235_high_3
Description: NF15235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15235_high_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 24 - 236
Target Start/End: Complemental strand, 28892861 - 28892649
Alignment:
| Q |
24 |
agcaacaaaccattgttgaagaagaaaaagaagcaatgtttgggttggatagaatggctaagaggatggttcaatttattctacgaatttctattccaac |
123 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28892861 |
agcaacgaaccattgttgaagaagaaaaagaagcaaagtttgggttggatagaatggttaagaggatggttcaatttattctacgaatttctattccaac |
28892762 |
T |
|
| Q |
124 |
gaatcctcgcaagtcatttacataaccctatgccattaccaccaatcaatgatctcacttgtattgttactggttctactagtggcattggtcttgaaat |
223 |
Q |
| |
|
||||| ||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28892761 |
gaatcacggcaagtcatttgcataatcctatgccgttaccaccaatcaatgatctcacttgtattgttactggttctactagtggcattggtcttgaaat |
28892662 |
T |
|
| Q |
224 |
tgcaaggtactac |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
28892661 |
tgcaaggtactac |
28892649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University