View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15236_low_4 (Length: 233)
Name: NF15236_low_4
Description: NF15236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15236_low_4 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 233
Target Start/End: Original strand, 41796852 - 41797068
Alignment:
| Q |
17 |
agcatgcctcgtctcgattcaataatcacttatgtaccaactacatgaatgaatggatttccaacacttaccaatgtaccgaccgcgtgaatgcggggat |
116 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41796852 |
agcatgcctcatctcgattcaataaccacttatgtaccaactacatgaatgaatggatttccaacacttaccaatgtaccgaccgcgtgaatacggggat |
41796951 |
T |
 |
| Q |
117 |
tacctatcacaacctatcccaattctaaactctaaacttaaaggtatctttcatctagaagaaaccaccgtccttgtgtccttgaaagtactgattcatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41796952 |
tacctatcacaacctatcccaattctaaactctaaacttaaaggtatctttcatctagaagaaaccaccgtccttgtgtccttgaaagtactgattcatg |
41797051 |
T |
 |
| Q |
217 |
catcatgcataactaaa |
233 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41797052 |
catcatgcataactaaa |
41797068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University