View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15236_low_6 (Length: 222)

Name: NF15236_low_6
Description: NF15236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15236_low_6
NF15236_low_6
[»] chr4 (1 HSPs)
chr4 (17-208)||(32539403-32539594)


Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 32539594 - 32539403
Alignment:
17 agagttgagcacaagcagagagatgagaatttggtattccacatgttgttgcaacttgtaaactattggaatttaattctgcaattatggttaaaagctc 116  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32539594 agagttgagcacaagcagagagatgagaatttggtattccgcatgttgttgcaacttgtaaactattggaatttaattctgcaattatggttaaaagctc 32539495  T
117 aattgaattcctcaaactttttatcttaagctcttttattgtcccttgatcatgtactaacttgtcaatattctcaatactcagtttcatct 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
32539494 aattgaattcctcaaactttttatcttaagctcttttattgtcccttgatcatgtactaacttgtcaatattctcaatactcaatttcatct 32539403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University