View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15236_low_6 (Length: 222)
Name: NF15236_low_6
Description: NF15236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15236_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 32539594 - 32539403
Alignment:
| Q |
17 |
agagttgagcacaagcagagagatgagaatttggtattccacatgttgttgcaacttgtaaactattggaatttaattctgcaattatggttaaaagctc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32539594 |
agagttgagcacaagcagagagatgagaatttggtattccgcatgttgttgcaacttgtaaactattggaatttaattctgcaattatggttaaaagctc |
32539495 |
T |
 |
| Q |
117 |
aattgaattcctcaaactttttatcttaagctcttttattgtcccttgatcatgtactaacttgtcaatattctcaatactcagtttcatct |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32539494 |
aattgaattcctcaaactttttatcttaagctcttttattgtcccttgatcatgtactaacttgtcaatattctcaatactcaatttcatct |
32539403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University