View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15237_high_23 (Length: 243)
Name: NF15237_high_23
Description: NF15237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15237_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 41460006 - 41460245
Alignment:
| Q |
1 |
gatttgcccgtgatcttgtccatgaatacaggcacctctgtagctaatattatttagaaccaagcttctcttaacatttctacctgagattgccgatgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41460006 |
gatttgcccgtgatcttgtccatgaatacaggcacctctgtagctaatattatttagaaccaagcttctcttaacatttctacctgagattgccgatgtc |
41460105 |
T |
 |
| Q |
101 |
cagcgacaaataataacgaatgtaatacgagttctatcaagtggttgtaactagtaaaagtaactgggaagggaaggtagcgaggcg--------tgtat |
192 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41460106 |
cagcgacaaataatatcgagtgtaatacgagttctgtcaagtggttgtaactagtaaaagtaactgggaagggaaggtagcgaggcgtgtacttttgtat |
41460205 |
T |
 |
| Q |
193 |
aactgctatgaatgattggctcatttttgtcatagtctgt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41460206 |
aactgctatgaatgattggctcatttttgtcatagtctgt |
41460245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University