View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15237_low_18 (Length: 315)
Name: NF15237_low_18
Description: NF15237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15237_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 102 - 300
Target Start/End: Complemental strand, 7668492 - 7668294
Alignment:
| Q |
102 |
tgtgtaggattacttttacgcctaccgttcgacactgtagtatggttactgtgattggtctttgtctcagagttaagctgaagcactattttcctgctca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7668492 |
tgtgtaggattacttttacgcctaccgttcgacactgtagtatggttactgtgattggtctttgtctcagagttaagctgaagcactattttcctgctca |
7668393 |
T |
|
| Q |
202 |
ttacaaagtttgtttcttcaacctttttgcttcacaagttattattatttagtatcagtgtgtgttttgttatgcagtgataaaaagtgagttgaatgt |
300 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
7668392 |
ttacaaagtttgtttcttcgacctttttgcttcacaagttattattatttagtatcagtgtgtcttttgttatgcagtgataaaaattgagttgaatgt |
7668294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 7668598 - 7668560
Alignment:
| Q |
1 |
ccatttctgttgatgacaaattgggtcggattctgtgag |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7668598 |
ccatttctgttgatgacaaattgggtcggattctgtgag |
7668560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University