View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15237_low_24 (Length: 272)
Name: NF15237_low_24
Description: NF15237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15237_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 8 - 168
Target Start/End: Original strand, 52851820 - 52851980
Alignment:
| Q |
8 |
ttggatcgatattgttgccacaccatccatgataaaatacgcttgagcaaattcaaaataataatgaaaatacataaatcatatgatacatatgacacat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52851820 |
ttggatcgatattgttgccacaccatccatgataaaatacgcttgagcaaattcaaaataataatgaaaatacataaatcatatgatacatatgacacat |
52851919 |
T |
 |
| Q |
108 |
cacttgctgactttggttgctaatttattttcataaccctttctttatttccacgtgaact |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52851920 |
cacttgctgactttggttgctaatttattttcataaccctttctttatttccacgtgaact |
52851980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 164 - 247
Target Start/End: Original strand, 52851999 - 52852082
Alignment:
| Q |
164 |
gaactaatatcttattacaaaagaatagggaagtttcttggattacaatgttgcagtccaactcaatcaaaatgcaagctacct |
247 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52851999 |
gaactaatatcttattacaaaaaaatagggaagtttcttggattacaatgttgcagtcaaactcaatcaaaatgcaagctacct |
52852082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 171 - 218
Target Start/End: Original strand, 30186929 - 30186976
Alignment:
| Q |
171 |
tatcttattacaaaagaatagggaagtttcttggattacaatgttgca |
218 |
Q |
| |
|
||||||||||||||||||||||||| ||| | ||||||||||||||| |
|
|
| T |
30186929 |
tatcttattacaaaagaatagggaacattcctagattacaatgttgca |
30186976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University