View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15237_low_28 (Length: 239)
Name: NF15237_low_28
Description: NF15237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15237_low_28 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 13264559 - 13264778
Alignment:
| Q |
19 |
aatacgtcagagaataatccagtggaagaaatttgatcttagactcagaagtttcaaaagctttttggtaatggaaatgaaaaacagattcaaaatcaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
13264559 |
aatacgtcagagaataatccagtggaagaa-tttgatcttagactcagaagtttcaaaagctttttggtaatggaaatgaaaaacagattcaaaatcaga |
13264657 |
T |
|
| Q |
119 |
tcgatgatcaaaattttcagaacttccacgtaaggttaacagattactagtatcatgttctctttgtattattctcttcattatattgatgtttacaaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13264658 |
tcgatgatcaaaattttcagaacttccacgaaaggttaacagattactagtatcatgttctctttgtattattctcttcattatattgatgtttacaaaa |
13264757 |
T |
|
| Q |
219 |
cacagatagtacaacacaatt |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
13264758 |
cacagatagtacaacacaatt |
13264778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University