View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15237_low_32 (Length: 216)
Name: NF15237_low_32
Description: NF15237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15237_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 51983278 - 51983099
Alignment:
| Q |
19 |
ttcaatcgggtcagaagacctttcaagaggttgaagatgtatgcacataatttttaaattcagtcattcagttttgtgggcatgccccattttctcgaac |
118 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51983278 |
ttcaatcgggtcaaaagacctttcaagaggttgaagatgtatgctcataatttttaaattcagtcattcagttttgtgggcgtgccccattttctcgaac |
51983179 |
T |
|
| Q |
119 |
cgactcaagcacttagtattaccaattttagtgccatatattattatcataatttattggcagttacggtttgcatttct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51983178 |
cgactcaagcacttagtattaccaattttagtgccatatattattatcataatttattggcagttacgatttgcatttct |
51983099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 92 - 191
Target Start/End: Complemental strand, 36837983 - 36837884
Alignment:
| Q |
92 |
ttgtgggcatgccccattttctcgaaccgactcaagcacttagtatta-ccaattttagtgccatatattattatcataatttattggcagttacggttt |
190 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||| | || |||| |||||||||| |||||| ||||| |||||||||||||||| |||||||||| |
|
|
| T |
36837983 |
ttgtgggtgtgccccattttctccaaccgactcaagca-tcagcattaaccaattttagcgccatacattataatcataatttattggctgttacggttt |
36837885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University