View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15237_low_33 (Length: 210)
Name: NF15237_low_33
Description: NF15237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15237_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 50 - 192
Target Start/End: Complemental strand, 33763056 - 33762915
Alignment:
| Q |
50 |
aacatgaactaacacatgcatatgaacacagattttatggtnnnnnnnccgaaccttttgaaatggagtttggtcagattgtcaaactagttgagaccag |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33763056 |
aacatgaactaacacatgcatatgaacacagattttatggtaaaaaa-ccgaaccttttgaaatggagtttggccagattgtcaaactagttgagaccag |
33762958 |
T |
 |
| Q |
150 |
atttatctgatgtatttctcagaagaacaaaattcgttgtgtg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33762957 |
atttatctgatgtatttctcagaagaacaaaattcgttgtgtg |
33762915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University