View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15238_low_4 (Length: 236)
Name: NF15238_low_4
Description: NF15238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15238_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 124 - 221
Target Start/End: Complemental strand, 3374870 - 3374773
Alignment:
| Q |
124 |
ttaccgtctagatccgctaaagaaacattcatgtcacctgaccttccctgactttccattggcatgaaccagccagataaagattgaatgtcatatct |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3374870 |
ttaccgtctagatccgctaaagaaacattcatgtcacctgaccttccgcgactttccattggcatgaaccagccagataaagattgaatgtcatatct |
3374773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 10 - 156
Target Start/End: Complemental strand, 3369105 - 3368959
Alignment:
| Q |
10 |
tattagcctttaaatattccatttgattttatagacatatagtttccttcacaggtacttacagttacaagacttgcagccaccaatggaccagctacgt |
109 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| || ||| || | ||| ||||||||||||| | || |||||||| |||||||||||||||||||| |
|
|
| T |
3369105 |
tattagcctctaaatattttatttgattttataaacctattattcctttcccaggtacttacagctgcaggacttgcaaccaccaatggaccagctacgc |
3369006 |
T |
 |
| Q |
110 |
gaccggcaacaacattaccgtctagatccgctaaagaaacattcatg |
156 |
Q |
| |
|
|||| |||||||||| || ||||||||| | ||||||||||||||| |
|
|
| T |
3369005 |
gaccaccaacaacatttccatctagatccacaaaagaaacattcatg |
3368959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 61 - 161
Target Start/End: Complemental strand, 3403057 - 3402957
Alignment:
| Q |
61 |
caggtacttacagttacaagacttgcagccaccaatggaccagctacgtgaccggcaacaacattaccgtctagatccgctaaagaaacattcatgtcac |
160 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||| ||||| ||||||||| || | ||||||| | ||||||||| ||||| ||| |
|
|
| T |
3403057 |
caggtacttacatttacaggacttgcagccaccaatggaccagctacgcgaccgccaacaacatgtccatgtagatccaccaaagaaacactcatgccac |
3402958 |
T |
 |
| Q |
161 |
c |
161 |
Q |
| |
|
| |
|
|
| T |
3402957 |
c |
3402957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University