View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15239_low_12 (Length: 243)
Name: NF15239_low_12
Description: NF15239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15239_low_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 51 - 243
Target Start/End: Complemental strand, 44241281 - 44241089
Alignment:
| Q |
51 |
aaatccctctccacgttagccaaaaccaccagcgtctccgccgcatctttcctcaccgcctaatcacaattactcaatgattccaccaaacacggaacca |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||| ||||| |||||||||||||||||||||| |
|
|
| T |
44241281 |
aaatccctctccacgttagccaaaaccaccagcgtctccgccgcagctttcctcaccgcccaatcacgattgctcaacgattccaccaaacacggaacca |
44241182 |
T |
 |
| Q |
151 |
atttcttcaacgaagcgtgactggacgcgccaccagcttcaaccacacttccgatcaacgtcaataatgccggtttcgccttaaacacttcac |
243 |
Q |
| |
|
| |||||||| |||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44241181 |
aattcttcaaagaagcgtgaccagacgcgccaccagcttcaacaacacttccgatcagcgtcaataatgccggtttcgccttaaacacttcac |
44241089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University