View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15239_low_9 (Length: 305)
Name: NF15239_low_9
Description: NF15239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15239_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 60 - 288
Target Start/End: Complemental strand, 2875011 - 2874796
Alignment:
| Q |
60 |
atattctaataacaaaattgagcttggattttctaatttatataaacaaaccaagcacaaataaaacaatctttgtcaaagcaagcacaacttctgacaa |
159 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2875011 |
atattctaataacaaaattgggtttggattttctaatttatataaac----caagcacaaataaaacaatctttatcaaagcaagcacaacttctgacaa |
2874916 |
T |
 |
| Q |
160 |
catagaaacaaagaaaatgcatagtgtaaatccccctagaagatttaatcttagaactaattctaacggtagaaattattctaataattctaattcatat |
259 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2874915 |
catagaaacaaagaaaatgcacagtgtaaatccccctagaagatttaatcttagaactaattctaacggtagaaattattc---------taattcatat |
2874825 |
T |
 |
| Q |
260 |
catgttcataaatcaacatgtttctattg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2874824 |
catgttcataaatcaacatgtttctattg |
2874796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University