View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1523_high_46 (Length: 264)
Name: NF1523_high_46
Description: NF1523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1523_high_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 38277003 - 38277201
Alignment:
| Q |
1 |
attagttcttcagcttacattaatgcatttgaatccatttt-ttatcagcagctatttcccattgatgacatgggtctattatatgaatataaagaaatg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38277003 |
attagttcttcagcttacattaatgcatttgaatccatttttttatcagcagctatttcccattgatgacatgggtctagtatatgaatataaagaaatg |
38277102 |
T |
 |
| Q |
100 |
gaattacannnnnnnnnac-attaaaactcagataatcttatgcttattattatatacggcctgctataggctgccacggttccgagctctagtgcaac |
197 |
Q |
| |
|
||||||| || ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38277103 |
gaattactattttttttactattaaaactcagagaatcttatgcttattattatatacggcctgctataggctgccacggttccgagctctagtgcaac |
38277201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 217 - 248
Target Start/End: Original strand, 38277230 - 38277261
Alignment:
| Q |
217 |
acgatattatttgactttctagttgtctctga |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38277230 |
acgatattatttgactttctagttgtctctga |
38277261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University