View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1523_high_50 (Length: 249)
Name: NF1523_high_50
Description: NF1523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1523_high_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 16758165 - 16757921
Alignment:
| Q |
1 |
aacaacttatactactccatgtgggacttgggaacccaataatactcgtatgagttctcctttgatgcattgatgttcagatgactcagtggcaaaccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16758165 |
aacaacttatactactccatgtgggacttgggaaccccataatactcgtatgagttctcctttgatgcattgatgttcagatgactcggtggcaaaccaa |
16758066 |
T |
|
| Q |
101 |
gttctagatcaatttttggcatactctttcatgaatcaactaactaacctattaccttgtgtcctcatatttcatttagcagagtcgatgcattttctaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16758065 |
gttctagatcaatttttggcatactcttgcatgaatcaactaactaacctattaccttgtgtcctcatatttcatttagcagagtcgatgtattttctaa |
16757966 |
T |
|
| Q |
201 |
attccatcgtcattgtcctcttttctccgtatggttcatctctct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||| ||||| |
|
|
| T |
16757965 |
attccatcgtcattgtcctcttttctccatattgttcatgtctct |
16757921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University