View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1523_low_38 (Length: 298)
Name: NF1523_low_38
Description: NF1523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1523_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 98 - 279
Target Start/End: Original strand, 49180320 - 49180501
Alignment:
| Q |
98 |
gaaaatgctgctagttgctattgaacgcggggaaggattcctgttaaattctttgtttaatgcagtgacttacaaaaatggctatatgccacgtataaga |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180320 |
gaaaatgctgctagttgctattgaacgcggggaaggattcctgttaaattctttgttcaatgcagtgacttacaaaaatggctatatgccacgtataaga |
49180419 |
T |
 |
| Q |
198 |
tgagtttgctgctacagggctggaagtcaggtttgagactgtgtctgtgttttgtttgatcttcctttcgttcactatgcat |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180420 |
tgagtttgctgctacagggctggaagtcaggtttgagactgtgtctgtgttttgtttgatcttcctttcgttcactatgcat |
49180501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 16 - 103
Target Start/End: Original strand, 49180160 - 49180247
Alignment:
| Q |
16 |
taggtcattaaaggtgaaaatcactaaatttgtccttcacctattgcatggttgacaactacataattgttaacttttgtgggaaaat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180160 |
taggtcattaaaggtgaaaatcactaaatttgtccttcacctattgcatggttgacaactacataattgttaacttttgtgggaaaat |
49180247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University