View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1523_low_40 (Length: 288)
Name: NF1523_low_40
Description: NF1523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1523_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 41 - 265
Target Start/End: Original strand, 8896936 - 8897160
Alignment:
| Q |
41 |
aattactatgactatagcgcctaccatcactagaagttcttgaattcttagtaaccgcatttgaaataacctctccaacattgccacaactattaatatg |
140 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
8896936 |
aattactatgattatagcgcctaccatcactagaagttcttgaattcttagtaaccgcatttgaaatagcctctccaacattgccacgactattaatatg |
8897035 |
T |
 |
| Q |
141 |
atttgaagcatgacaaaagtcattgccaaaaccctgaccagcactaggagaatcatgcactgcatgatccaaatcagnnnnnnnagcaaggttttggttg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
8897036 |
atttgaagcatgacaaaagtcattgccaaaaccctgaccagcactaggagaatcatgcactgcatgatccaaatcagttttttcagtaaggttttggttg |
8897135 |
T |
 |
| Q |
241 |
tgaaaactgtagttagcgtcataac |
265 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8897136 |
tgaaaactgtagttagcgtcataac |
8897160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University