View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1523_low_44 (Length: 281)
Name: NF1523_low_44
Description: NF1523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1523_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 62 - 265
Target Start/End: Complemental strand, 8152719 - 8152516
Alignment:
| Q |
62 |
ttgaaaacaagagctacaaaagagggggttccgatggtggtcgtcaagactgaggatgtgtgggtggtaccattgaaaggattaaattgtggaacatcca |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8152719 |
ttgaaaacaagagctacaaaagagggggtttttgttgtggtcgtcaagactgaggatgtgtgggtggtaccattgaaaggattaaattgtggaacatcca |
8152620 |
T |
 |
| Q |
162 |
tggttgaagaaaatgaggagatgaggctgctaaataaagcaagagcattcccctcttgcagaaggaagaacccccggccgaagttaactcaacatcgttg |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8152619 |
tggttgaagaaaatgaggagatgaggctgctaaataaagcaagagcattcccctcttgcagaaggaagaacccccgcccgaagttaactcaacatcgttg |
8152520 |
T |
 |
| Q |
262 |
gtga |
265 |
Q |
| |
|
|||| |
|
|
| T |
8152519 |
gtga |
8152516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University