View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1523_low_61 (Length: 235)

Name: NF1523_low_61
Description: NF1523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1523_low_61
NF1523_low_61
[»] chr1 (1 HSPs)
chr1 (1-110)||(38225306-38225416)


Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 38225306 - 38225416
Alignment:
1 cttggtgtcttttgtgtccatatcagatgctaccgtcctgt-aggttaggttgcttgcaactagtagaagccgaatcatcgccactagctagcactactt 99  Q
    |||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38225306 cttggtgtcttttgtgtccatatcagatgccaccgtcctgttaggttaggttgcttgcaactagtagaagccgaatcatcgccactagctagcactactt 38225405  T
100 tgtgagatttt 110  Q
    |||||||||||    
38225406 tgtgagatttt 38225416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University