View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1524-Insertion-13 (Length: 332)
Name: NF1524-Insertion-13
Description: NF1524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1524-Insertion-13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 8 - 317
Target Start/End: Original strand, 41849544 - 41849837
Alignment:
| Q |
8 |
gattgtccaaacaaaaccttagtctaatatgcaatgcaacttacattcacaactgcaggtaagctaggcaagcaagagaacctactaatctattaattat |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41849544 |
gattgtccaaacacaaccttagtctaatatgcaatgcaacttacattcacaactgcagataagttagggaagcaagagaacctactaatctattaattat |
41849643 |
T |
|
| Q |
108 |
atgaattgtttacccgcttttatatatcaaaatatgtatgaattatgcaatatagcaaattgttgcatagagtgataggctagttagtgatgagcgagtg |
207 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| ||| |
|
|
| T |
41849644 |
atgaattgtttacccacttttatatatcaaaatatgtatgaattatgcaatatagaaaattgtt----------------tagttagtgatgagcgggtg |
41849727 |
T |
|
| Q |
208 |
ttaatattttcaggtgaatttgaagtttgaacctgagtagcagcagtaacgggaaatgaagcagaagtaacagcataagctgcaagaataccacaggcaa |
307 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41849728 |
ttaatattttcaggtgaatttgaggtttgaacctgagtagcagcagtaacgggaaatgaagcagaagtaacagcataagctgcaagaataccacaggcaa |
41849827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University