View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1524-Insertion-14 (Length: 124)
Name: NF1524-Insertion-14
Description: NF1524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1524-Insertion-14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 1e-29; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 1e-29
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 28442259 - 28442357
Alignment:
| Q |
8 |
tcaacgccagcgatcaagcgcgtaaattcattgcaattccctt--------ggcacccttttagaccttagaagaataattagaagaaaagttggataa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28442259 |
tcaacgccagcgatcaagcgcgtaaattcattgcaattcccttcctaaactggcacccttttagaccatagaagaataattagaagaaaagttggataa |
28442357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University