View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1524-Insertion-16 (Length: 121)
Name: NF1524-Insertion-16
Description: NF1524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1524-Insertion-16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 3e-55; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 6 - 118
Target Start/End: Original strand, 37796363 - 37796475
Alignment:
| Q |
6 |
catatgctgctatgaatatcatgtgcaagctcgttataaatgatgggatgagtatgagggtggcgactgcttaccgcctcatttgtgcatcagctttcac |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37796363 |
catatgctgctatgaatatcatgtgcaagctcgttataaatgatgggatgagtatgagggttgcgactgcttaccgcctcatttgtgcatcagctttcac |
37796462 |
T |
|
| Q |
106 |
tattccagttgcc |
118 |
Q |
| |
|
||||||||||||| |
|
|
| T |
37796463 |
tattccagttgcc |
37796475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 5e-32
Query Start/End: Original strand, 6 - 111
Target Start/End: Original strand, 37806403 - 37806508
Alignment:
| Q |
6 |
catatgctgctatgaatatcatgtgcaagctcgttataaatgatgggatgagtatgagggtggcgactgcttaccgcctcatttgtgcatcagctttcac |
105 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| || |||| ||||||||| || ||||||||||||||| |
|
|
| T |
37806403 |
catatgctgctgtgaatatcatgtacaagctcgttataaatgatgggatgagtatgagggttgcttctgcctaccgcctcgcttttgcatcagctttcac |
37806502 |
T |
|
| Q |
106 |
tattcc |
111 |
Q |
| |
|
|||||| |
|
|
| T |
37806503 |
tattcc |
37806508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 18 - 111
Target Start/End: Original strand, 37785733 - 37785826
Alignment:
| Q |
18 |
tgaatatcatgtgcaagctcgttataaatgatgggatgagtatgagggtggcgactgcttaccgcctcatttgtgcatcagctttcactattcc |
111 |
Q |
| |
|
|||||||||| |||||||| | ||||||||||||||||| ||||||||||| ||||||||||| |||| || ||||||||||||||| ||||| |
|
|
| T |
37785733 |
tgaatatcatatgcaagcttgccataaatgatgggatgagcatgagggtggccactgcttaccgtctcacttttgcatcagctttcaccattcc |
37785826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 50; E-Value: 4e-20
Query Start/End: Original strand, 10 - 111
Target Start/End: Original strand, 37778601 - 37778702
Alignment:
| Q |
10 |
tgctgctatgaatatcatgtgcaagctcgttataaatgatgggatgagtatgagggtggcgactgcttaccgcctcatttgtgcatcagctttcactatt |
109 |
Q |
| |
|
||||||| |||||||||||| ||||||||| ||||| ||||| ||||| ||||||||||| || ||||||||||||| || |||| | ||||||||| || |
|
|
| T |
37778601 |
tgctgctgtgaatatcatgtacaagctcgtcataaacgatggaatgagcatgagggtggccaccgcttaccgcctcagttttgcagcggctttcactgtt |
37778700 |
T |
|
| Q |
110 |
cc |
111 |
Q |
| |
|
|| |
|
|
| T |
37778701 |
cc |
37778702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University