View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1524-Insertion-19 (Length: 61)
Name: NF1524-Insertion-19
Description: NF1524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1524-Insertion-19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.000000000000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.000000000000004
Query Start/End: Original strand, 8 - 60
Target Start/End: Original strand, 52447216 - 52447268
Alignment:
| Q |
8 |
catgttgatttggaagctctcccagttactcttttgagattttatttatggat |
60 |
Q |
| |
|
|||||| |||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
52447216 |
catgttcatttggaagctctctcaattactcttttgagattttatttatggat |
52447268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.00000000000007
Query Start/End: Original strand, 8 - 54
Target Start/End: Original strand, 52446280 - 52446326
Alignment:
| Q |
8 |
catgttgatttggaagctctcccagttactcttttgagattttattt |
54 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
52446280 |
catgttgatttggaagttctcccagttactcttttgagatttgattt |
52446326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University