View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15240_high_1 (Length: 347)
Name: NF15240_high_1
Description: NF15240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15240_high_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 73; Significance: 3e-33; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 21 - 110
Target Start/End: Original strand, 7907799 - 7907890
Alignment:
| Q |
21 |
ttcaagaaccactcttagttccttgtcatgtgattggagcatcctat--gtctaggtactaaaaattggatttgtcactttcctatgtagta |
110 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7907799 |
ttcaggaaccactctttgttccttgtcatgtgattggagcatcctatatgtctaggtactaaaaattggatttgtcactttcctatgtagta |
7907890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 228 - 336
Target Start/End: Original strand, 7917236 - 7917340
Alignment:
| Q |
228 |
tacccaaaacttttacggttgtagcattatacattcttattactgaacttcaatttaccacgattgtaacttccacctcctttatttttagtccattcaa |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| | |||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
7917236 |
tacccaaaacttttacggttgtagcattatacattcttattact----ttcactttaccatgcttgtaacttccacctcctttatttatagtcaattcaa |
7917331 |
T |
 |
| Q |
328 |
catgattct |
336 |
Q |
| |
|
||||||||| |
|
|
| T |
7917332 |
catgattct |
7917340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University