View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15241_low_6 (Length: 270)
Name: NF15241_low_6
Description: NF15241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15241_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 24 - 252
Target Start/End: Original strand, 28979903 - 28980128
Alignment:
| Q |
24 |
ttttggagggattaatactgatgataacaatggtagtgtatcttggtatggaatgaggttacctgttaacccctttttgtcaccgatttcgtttttgttg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28979903 |
ttttggagggattaatactgatgataacaatggtagtgtatcttggtatggaatgaggttacctgttaacccctttttgtcaccgatttcgtttttgttg |
28980002 |
T |
|
| Q |
124 |
gattattctggaattttgcgttcgggtaatgattctgagggtatgattgtcaacaatggtggagtttctggttcggagttacgacctcaggttgatgctg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28980003 |
gattattctggaattttgcgttcgggtaatgattctgagggtatgattgtcaacaa---tggagtttctggttcggagttacgacctcaggttgatgctg |
28980099 |
T |
|
| Q |
224 |
gtggtgctgttgctgggagtagtgcaggg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28980100 |
gtggtgctgttgctgggagtagtgcaggg |
28980128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University