View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15242_high_3 (Length: 286)
Name: NF15242_high_3
Description: NF15242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15242_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 267
Target Start/End: Original strand, 46103718 - 46103965
Alignment:
| Q |
20 |
tatcgctggcagttctttcccaccataacaaacatactatgcgagccagaaattgaaatgaaaacattaaaa-ttgcatgaatgaatttggtggtaatag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46103718 |
tatcgctggcagttctttcccaccataacatacatact-tgcaagcgagaaattgaaatgaaaacattaaaaattgcatgaatgaatttggtggtaatag |
46103816 |
T |
 |
| Q |
119 |
taatacaaaatcagtttcgttagtaaatcagcactcattcattcattcatcatggccatggccatggcctttcaaacaacacactcttatctaaccacaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46103817 |
taatacaaaatcagtttcgttagtaaatcagcactcattcattcattcatcatggccatggccatggcctttcaaacaacacactcttatctaaccacaa |
46103916 |
T |
 |
| Q |
219 |
caaacttcatcttctcctctagtctcaaacgactcaccaaaccttctcg |
267 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46103917 |
caaacttcatcttctcttctagtctcaaacgactcaccaaaccttctcg |
46103965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University