View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15242_low_7 (Length: 278)
Name: NF15242_low_7
Description: NF15242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15242_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 19 - 266
Target Start/End: Complemental strand, 28001347 - 28001100
Alignment:
| Q |
19 |
actagtaacaacaactagcaacaatacttagaagcgtgatggcttgtccgcacgagcgggcctctcgcgtcccaagctcatgataatttcaatttgcaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28001347 |
actagtaacaacaactagcaacaatacttagaagcgtgatggcttgtccgcacgagcgggcctctcgcgtcccaagctcatgataatttcaatttgcaat |
28001248 |
T |
|
| Q |
119 |
gttctctgtattttgctgcatttgccattttgtgactactatttaattggtgtctgtaggatcagataaatatcaatggacacactgcatgcatagttta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28001247 |
gttctctgtattttgctgcatttgccattttgtgactactatttaattggtgtctgtaggatcagataaatatcaatggacacactgcatgcatagttta |
28001148 |
T |
|
| Q |
219 |
ttattaatcaatttgtctttaatcgctagcaccaatgttcaatgttca |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28001147 |
ttattaatcaatttgtctttaatcgctagcaccaatattcaatgttca |
28001100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University