View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15244_high_3 (Length: 215)
Name: NF15244_high_3
Description: NF15244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15244_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 35 - 188
Target Start/End: Original strand, 54642483 - 54642636
Alignment:
| Q |
35 |
ccaacgccaacttaggcctttgtgattcgtaaaaaatgtcacaagttatacgtgtcaatctctcagtaaattgatcttgctctcatgcatggacatagcc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54642483 |
ccaacgccaacttaggcctttgtgattcgtaaaaaatgtcacaagttatacgtgtcaatctctcagtaaattgatcttgctctcatgcatggacatagcc |
54642582 |
T |
|
| Q |
135 |
gttttcaccttttctatctccgaagattaaaaaagtcctaatgtgtttgatatt |
188 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54642583 |
gtttttaccttttctatctccgaagattaaaaaagtcctaatgtgtttgatatt |
54642636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University