View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15245_high_11 (Length: 226)
Name: NF15245_high_11
Description: NF15245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15245_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 209
Target Start/End: Complemental strand, 28805712 - 28805522
Alignment:
| Q |
19 |
atcatgttaaagtattatctcttccaatgtgagactcttaacgcacccactcgcacctagtattggacatctggggcgtgactaaacatattgggaaaga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28805712 |
atcatgttaaagtattatctcttccaatgcgagactcttaacgcacccactcgcacctagtattggacatctggggcgtgactaaacatattggcaaaga |
28805613 |
T |
|
| Q |
119 |
aagaacacaaaccttgaggataaattcctttgagaaaaacaacagaagtaatagcaacttccaaaaattcaaccaaaacccgacctatttg |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28805612 |
aagaacacaaaccttgaggataaatccctttaagaaaaacaacagaggtaatagcaacttccaaaaattcaaccaaaacccgacctatttg |
28805522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University