View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15245_low_13 (Length: 226)

Name: NF15245_low_13
Description: NF15245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15245_low_13
NF15245_low_13
[»] chr2 (1 HSPs)
chr2 (19-209)||(28805522-28805712)


Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 209
Target Start/End: Complemental strand, 28805712 - 28805522
Alignment:
19 atcatgttaaagtattatctcttccaatgtgagactcttaacgcacccactcgcacctagtattggacatctggggcgtgactaaacatattgggaaaga 118  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
28805712 atcatgttaaagtattatctcttccaatgcgagactcttaacgcacccactcgcacctagtattggacatctggggcgtgactaaacatattggcaaaga 28805613  T
119 aagaacacaaaccttgaggataaattcctttgagaaaaacaacagaagtaatagcaacttccaaaaattcaaccaaaacccgacctatttg 209  Q
    ||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
28805612 aagaacacaaaccttgaggataaatccctttaagaaaaacaacagaggtaatagcaacttccaaaaattcaaccaaaacccgacctatttg 28805522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University