View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15245_low_9 (Length: 269)
Name: NF15245_low_9
Description: NF15245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15245_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 7 - 238
Target Start/End: Complemental strand, 34519183 - 34518952
Alignment:
| Q |
7 |
ggcagactctatatttccctttttagtggtttttagttttcatgtttgaaaaatataattatgcactatgtggctagacaacatatctggcataaatatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34519183 |
ggcagactctatatttccctttttagtggtttttagttttcatgtttgaaaaatataattatgcactatgtggctagacaacatatctggcataaatatt |
34519084 |
T |
|
| Q |
107 |
gctaaacaaccatattattatataaaaacaaaagttgttctcgtgactgatgttgattaaacactaataaccaatgaaaataattgcaagagagcttgca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34519083 |
gctaaacaaccatattattatataaaaacaaaagttgttcccgtgactgatgttgattaaacactaataaccaatgaaaataattgcaagagagcttgca |
34518984 |
T |
|
| Q |
207 |
acttgtaaattgttgtgttgtgatcacaggtt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34518983 |
acttgtaaattgttgtgttgtgatcacaggtt |
34518952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University