View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15246_low_2 (Length: 271)
Name: NF15246_low_2
Description: NF15246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15246_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 18 - 270
Target Start/End: Original strand, 11033792 - 11034027
Alignment:
| Q |
18 |
atcaaaccaagaaaacgggtcataaactttgataatgaaagcttcattcgtcattagccggcttgtcacttataaggttcaattaacatcactgttacca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
11033792 |
atcaaaccaagaaaacgggtcataaactttgataatgaaagcttcattcgtcattagccggcttgtcacttataaggttcaatt-atatcactgttacca |
11033890 |
T |
|
| Q |
118 |
tttatttctttctctctagcttcacatgatcatagcttcacatgatcattgatcatggcagatgatgatggtgaccatcctttttataagaactttattg |
217 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11033891 |
tttatttctttctctctagc----------------ttcacatgatcattgatcatggcagatgatgatggtgaccatcctttttataagaactctattg |
11033974 |
T |
|
| Q |
218 |
tcctacttattgtcgtgggttcagctgcatttgtggttgcttcaatgtaccgt |
270 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11033975 |
tactacttattgtcgtgggttcagctgcatttgtggttgcttcaatgtaccgt |
11034027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University