View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15246_low_3 (Length: 254)
Name: NF15246_low_3
Description: NF15246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15246_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 120 - 245
Target Start/End: Original strand, 32430598 - 32430723
Alignment:
| Q |
120 |
tggttaggaagtgccgcatcatctggttgacatacttcatccatctgaaggtctgttttctttgatactaagctatatttgtttaagcaaggattcatat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32430598 |
tggttaggaagtgccgcatcatctggttgacatacttcatccatctgaaggtctgttttctttgatactaagctatatttgtttaagcaaggattcatat |
32430697 |
T |
|
| Q |
220 |
acgaatatcctcatattcatctctct |
245 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
32430698 |
acgaatatcctcatattcatttctct |
32430723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 32430479 - 32430547
Alignment:
| Q |
1 |
ttgctattgtgacttggattgcctgtcgtaactttttcgatttgttatttagtcgtaacatcgaattgg |
69 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32430479 |
ttgccattgtgacttggattgcctgtcgtaactttttcgatttgttatttagtcgtaacatcgaattgg |
32430547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University