View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15248_high_5 (Length: 338)
Name: NF15248_high_5
Description: NF15248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15248_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 1 - 181
Target Start/End: Original strand, 17984132 - 17984316
Alignment:
| Q |
1 |
agacgaaattgattgcaaagtaagatgtgcatggcttggctattgatagttatatgcaacttcattttcttttgttatattgataagaagtttcaaggca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17984132 |
agacgaaattgattgcaaagtaagatgtgcatggcttggctattgataggtatatgcaacttcattttctcttgttatattgataagaagtttcaaggca |
17984231 |
T |
 |
| Q |
101 |
cg----taaggtggattctcctctttgaattgaatctcttttatttatccattcaagttatttattttatgtcataaattttatt |
181 |
Q |
| |
|
|| ||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17984232 |
cgtacttaaggtgaattctcctctttgaactgaatctcttttatttatccattcaagttatttattttatgtcataaattttatt |
17984316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 217
Target Start/End: Original strand, 26537969 - 26538006
Alignment:
| Q |
180 |
ttgggataatggtgctttaccccatgtaatatatgtca |
217 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
26537969 |
ttgggttaatggtgctttaccccttgtaatatatgtca |
26538006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 5031921 - 5031957
Alignment:
| Q |
181 |
tgggataatggtgctttaccccatgtaatatatgtca |
217 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
5031921 |
tgggttaatggtgctttaccccctgtaatatatgtca |
5031957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University