View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15248_low_13 (Length: 213)
Name: NF15248_low_13
Description: NF15248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15248_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 25 - 194
Target Start/End: Complemental strand, 6047740 - 6047571
Alignment:
| Q |
25 |
gataatttttgttttgatgatttgaagggaaagtcgcactaaaaatatgtgtacaaacaatttagcccaagtaaatataagcaaggatctttcgtggcat |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6047740 |
gataatttttgttttgatgatttgaagggaaagtcgcactaaaaatatgtgtacaaacaatttagcccaagtaaatataagcaaggatctttcgtggcat |
6047641 |
T |
 |
| Q |
125 |
aagctaaagttcttgtgttcaaaacgctaatgccaatcacaactagttttgtgataataaatggacagcg |
194 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6047640 |
aagctaaagttcttgtgttcaaaacgcgaatgccaatcacaactagttttgtgataataaatggacagcg |
6047571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University