View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15248_low_8 (Length: 375)
Name: NF15248_low_8
Description: NF15248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15248_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 201 - 365
Target Start/End: Complemental strand, 27836392 - 27836227
Alignment:
| Q |
201 |
catattttaattaaactgagacttta-ttgttctaataactaataattccaagtacagtttatggtaattgcttgtgcagattcaagggtatgcccctct |
299 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27836392 |
catattttaattaaactgagactttaattgttctaataactaataaatccaagtacagtttatggtaattgcttgtgcagattcaagggtgtgcccctct |
27836293 |
T |
|
| Q |
300 |
aacatattaggattccaacctggtgaagtctttatgatacgtaacattgccaatcttgtacctatg |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27836292 |
aacatattaggattccaacctggtgaagtctttatgatacgtaacattgccaatcttgtgcctatg |
27836227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 27836606 - 27836429
Alignment:
| Q |
19 |
caagtatcttataaactattttcttttagacaggaaagagttggagcattatgaatctcttgctgaagctcaatatccaaaggtgattaacaaatagatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27836606 |
caagtatcttataaactattttcttttagacaggaaagagttggaccattatgaatctcttgctgaagctcaatatccaaaggtgattaacaaatagatt |
27836507 |
T |
|
| Q |
119 |
tcagaagtccatttattcaannnnnnnccctatactatcaaatcattttcacaaataatctccacaacaacacattttg |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
27836506 |
tcagaagtccatttattcaatttttttccctatactatcaaatcatcttcacaaataatctccacaac-acacattttg |
27836429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 246 - 319
Target Start/End: Complemental strand, 1939655 - 1939582
Alignment:
| Q |
246 |
ttccaagtacagtttatggtaattgcttgtgcagattcaagggtatgcccctctaacatattaggattccaacc |
319 |
Q |
| |
|
||||||| |||||| ||||| ||||| ||||||||||| |||||||||||||| || || || ||||| ||||| |
|
|
| T |
1939655 |
ttccaagaacagttcatggttattgcctgtgcagattccagggtatgcccctccaatattttgggatttcaacc |
1939582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University