View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15249_low_4 (Length: 234)
Name: NF15249_low_4
Description: NF15249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15249_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 32430198 - 32430097
Alignment:
| Q |
1 |
caaaaaataaacaaccacatttcgttcttaaccaatttctcacttaaaaataaataaaccccctaatcaaggtagttaaaatcaggtaggggaagtaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32430198 |
caaaaaataaacaaccacatttcgttcttaaccaatttctcacttaaaaataaataaacctcctaatcaaggtagttaaaatcaggtaggggaagtaaaa |
32430099 |
T |
|
| Q |
101 |
ta |
102 |
Q |
| |
|
|| |
|
|
| T |
32430098 |
ta |
32430097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 99 - 217
Target Start/End: Complemental strand, 32429105 - 32428986
Alignment:
| Q |
99 |
aataatacattcaaaagaaaatcacttcaaatagtgcnnnnnnn-taaagagtattgatttttgtttgaaatttttatcgtaacttgatacctgaacaga |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32429105 |
aataatacattcaaaagaaaatcacttcaaatagtgcaaaaaaaataaagagtattcatttttgtttgaattttttatcgtaacttgatacctgaacaga |
32429006 |
T |
|
| Q |
198 |
atcggcactaacgatttcac |
217 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
32429005 |
atcggcactaacgatttcac |
32428986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University