View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1524R-Insertion-12 (Length: 113)
Name: NF1524R-Insertion-12
Description: NF1524R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1524R-Insertion-12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 5e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 5e-41
Query Start/End: Original strand, 25 - 113
Target Start/End: Complemental strand, 19278272 - 19278184
Alignment:
| Q |
25 |
tgtgggtggtactgcacaatgtgtaatggaagacacacctttttccttagacggcttttctttgcagcttctctgttttgtgccaaacg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19278272 |
tgtgggtggtactgcacaatgtgtaatggaagacacacctttttcctcagacggcttttctttgcagcttctctgttttgtgccaaacg |
19278184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.0000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 61 - 113
Target Start/End: Complemental strand, 36333990 - 36333938
Alignment:
| Q |
61 |
acctttttccttagacggcttttctttgcagcttctctgttttgtgccaaacg |
113 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| || ||||||||||| ||||| |
|
|
| T |
36333990 |
acctttttccttagacgacttttccttgcagcctccctgttttgtgctaaacg |
36333938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University