View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1524_low_4 (Length: 287)
Name: NF1524_low_4
Description: NF1524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1524_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 3 - 271
Target Start/End: Original strand, 41210839 - 41211099
Alignment:
| Q |
3 |
tcgaagaatatttataaaggcatttatatttaccttccttcaaaggtatcagtgaagcgcgaacattgaatttggtttggtttaagnnnnnnnttataat |
102 |
Q |
| |
|
||||| || ||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
41210839 |
tcgaaaaacatttataaaggtatttatatttaccttccttcaaaggtaccagtgaagcgcgaatattgaatttggtttggtttaagaaaaaa-ttataat |
41210937 |
T |
 |
| Q |
103 |
cacnnnnnnnnnnnactcaagaattattttattataactgaaacacacnnnnnnnnnnnngttgaacagctaataattcttagacgatagataactttgt |
202 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
41210938 |
aactttttttttt-actcaagaattattttattataactgaaacaca---aaaaaaaaaagttgaacagctactaattcttagacgatagatagctttgt |
41211033 |
T |
 |
| Q |
203 |
gactaaaaagtaaaaacagaagaaaagatagtagtatgatattgacgggtaaaacaaagacaaagcaac |
271 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41211034 |
gactaaaaagtaaaaacagaagaaaaga---tactatgatattgacgggtaaaacaaagacaaagcaac |
41211099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University