View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15250_low_3 (Length: 258)
Name: NF15250_low_3
Description: NF15250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15250_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 247
Target Start/End: Original strand, 38174601 - 38174829
Alignment:
| Q |
19 |
aggtagaaatactcatctcaaccaaaattgtggcagctgagtgttatagaaatctgactgaattttcatcagagtagcgcatttttgcatttaatcaacc |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38174601 |
aggtagaaatactcatcttaaccaaaattgtggcagctgagtgttatagaaatctgactgaattttcatcagagtagcgcatttttgcatttaatcaacc |
38174700 |
T |
|
| Q |
119 |
tgatgaatatgtggcagctgcatcttcatttttgtcatgtgaaatacgaaacatggaaacttgttattgattcgatgatgaacaaattagctaatcggaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38174701 |
tgatgaatatgtggcagctgcatcttcatttttgtcatgtgaaatacgaaatatggaaactttttattgattcgatgatgaacaaattagctaataggaa |
38174800 |
T |
|
| Q |
219 |
aggtaaacatttgtactccttcatctcac |
247 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
38174801 |
aggtaaacatttgtactccttcatgtcac |
38174829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University