View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15251_low_12 (Length: 251)

Name: NF15251_low_12
Description: NF15251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15251_low_12
NF15251_low_12
[»] chr6 (2 HSPs)
chr6 (1-239)||(9824850-9825088)
chr6 (21-62)||(426590-426631)
[»] chr1 (1 HSPs)
chr1 (14-60)||(47989442-47989488)
[»] chr3 (1 HSPs)
chr3 (21-68)||(52369731-52369778)
[»] chr4 (1 HSPs)
chr4 (21-62)||(40774223-40774264)


Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 9825088 - 9824850
Alignment:
1 cttaaattattttgtgtctttgtcgtgtctggtatccgtgtctgtttccttgcttcatagatggtaacttaacacgatcgttgttaaattgttgtgttta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9825088 cttaaattattttgtgtctttgtcgtgtctggtatccgtgtctgtgtccttgcttcatagatggtaacttaacacgatcgttgttaaattgttgtgttta 9824989  T
101 ttactaatctctatatccttataccgatttgtttagttggtccattttatgtcaaagttaggaaggctcaaaaatgcaatacgtaagatcttattaataa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
9824988 ttactaatctctatatccttataccgatttgtttagttggtccattttatgtcaaagttaggaaggctcaaaaatgcaattcgtaagatcttattaataa 9824889  T
201 gttattattcactctgaaaaaactgtgtttgccaatttt 239  Q
    |||||||||||||||||||||||||||||||||||||||    
9824888 gttattattcactctgaaaaaactgtgtttgccaatttt 9824850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 62
Target Start/End: Original strand, 426590 - 426631
Alignment:
21 tgtcgtgtctggtatccgtgtctgtttccttgcttcatagat 62  Q
    ||||||||| ||||||||||||||| ||| ||||||||||||    
426590 tgtcgtgtccggtatccgtgtctgtatccatgcttcatagat 426631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 14 - 60
Target Start/End: Complemental strand, 47989488 - 47989442
Alignment:
14 gtgtctttgtcgtgtctggtatccgtgtctgtttccttgcttcatag 60  Q
    |||||| ||||||||||||||||||||||||| ||| ||||||||||    
47989488 gtgtctgtgtcgtgtctggtatccgtgtctgtatccatgcttcatag 47989442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 68
Target Start/End: Complemental strand, 52369778 - 52369731
Alignment:
21 tgtcgtgtctggtatccgtgtctgtttccttgcttcatagatggtaac 68  Q
    ||||||||| ||| ||||||||||| ||| ||||||||||||||||||    
52369778 tgtcgtgtccggtgtccgtgtctgtgtccgtgcttcatagatggtaac 52369731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 62
Target Start/End: Complemental strand, 40774264 - 40774223
Alignment:
21 tgtcgtgtctggtatccgtgtctgtttccttgcttcatagat 62  Q
    ||||||||||||||||||||||||| ||| || |||||||||    
40774264 tgtcgtgtctggtatccgtgtctgtatccgtgtttcatagat 40774223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University