View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15251_low_12 (Length: 251)
Name: NF15251_low_12
Description: NF15251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15251_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 9825088 - 9824850
Alignment:
| Q |
1 |
cttaaattattttgtgtctttgtcgtgtctggtatccgtgtctgtttccttgcttcatagatggtaacttaacacgatcgttgttaaattgttgtgttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9825088 |
cttaaattattttgtgtctttgtcgtgtctggtatccgtgtctgtgtccttgcttcatagatggtaacttaacacgatcgttgttaaattgttgtgttta |
9824989 |
T |
|
| Q |
101 |
ttactaatctctatatccttataccgatttgtttagttggtccattttatgtcaaagttaggaaggctcaaaaatgcaatacgtaagatcttattaataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9824988 |
ttactaatctctatatccttataccgatttgtttagttggtccattttatgtcaaagttaggaaggctcaaaaatgcaattcgtaagatcttattaataa |
9824889 |
T |
|
| Q |
201 |
gttattattcactctgaaaaaactgtgtttgccaatttt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9824888 |
gttattattcactctgaaaaaactgtgtttgccaatttt |
9824850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 62
Target Start/End: Original strand, 426590 - 426631
Alignment:
| Q |
21 |
tgtcgtgtctggtatccgtgtctgtttccttgcttcatagat |
62 |
Q |
| |
|
||||||||| ||||||||||||||| ||| |||||||||||| |
|
|
| T |
426590 |
tgtcgtgtccggtatccgtgtctgtatccatgcttcatagat |
426631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 14 - 60
Target Start/End: Complemental strand, 47989488 - 47989442
Alignment:
| Q |
14 |
gtgtctttgtcgtgtctggtatccgtgtctgtttccttgcttcatag |
60 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
47989488 |
gtgtctgtgtcgtgtctggtatccgtgtctgtatccatgcttcatag |
47989442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 68
Target Start/End: Complemental strand, 52369778 - 52369731
Alignment:
| Q |
21 |
tgtcgtgtctggtatccgtgtctgtttccttgcttcatagatggtaac |
68 |
Q |
| |
|
||||||||| ||| ||||||||||| ||| |||||||||||||||||| |
|
|
| T |
52369778 |
tgtcgtgtccggtgtccgtgtctgtgtccgtgcttcatagatggtaac |
52369731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 62
Target Start/End: Complemental strand, 40774264 - 40774223
Alignment:
| Q |
21 |
tgtcgtgtctggtatccgtgtctgtttccttgcttcatagat |
62 |
Q |
| |
|
||||||||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
40774264 |
tgtcgtgtctggtatccgtgtctgtatccgtgtttcatagat |
40774223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University