View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15251_low_14 (Length: 247)
Name: NF15251_low_14
Description: NF15251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15251_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 2 - 229
Target Start/End: Original strand, 36037646 - 36037874
Alignment:
| Q |
2 |
gtgagtctctcatagtctttcaatcagagtagtcacttcaaggacaaagactcttactgttattatcatcgttggagtttcaaattatggtatccttcca |
101 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
36037646 |
gtgattctctcatagtctttctatcagagtagtcacttcaaggacaaagactcttactgctattatcatcgttggagtttcaaatcatggtattcttcca |
36037745 |
T |
 |
| Q |
102 |
tgtgaaaatcaaccccagtgtgagtgttcagggtatcacactt--nnnnnnnngtgttcttatttgagaatgaaatcaaataaaagtaaagaatatgctt |
199 |
Q |
| |
|
|||| |||||||| ||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36037746 |
tgtg-aaatcaacaccagtgtgagtgttctgggtatcacacttaaaaaaaaaagtgttcttatttgagaatgaaatcaaataaaagcaaagaatatgctt |
36037844 |
T |
 |
| Q |
200 |
tatgaacttacagagatatcctctcaaagt |
229 |
Q |
| |
|
||||||||||||||| |||||||||||||| |
|
|
| T |
36037845 |
tatgaacttacagaggtatcctctcaaagt |
36037874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University