View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15252_high_3 (Length: 347)
Name: NF15252_high_3
Description: NF15252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15252_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 102 - 247
Target Start/End: Original strand, 34561580 - 34561725
Alignment:
| Q |
102 |
aaatctttgcctaaaaaggaatattttatccagatactataatctagtatagttttaggataatgtagtttgtttatattttctccgtacaaagaagtac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34561580 |
aaatctttgcctaaaaaggaatattttatccagatactatagtctagtatagttttaggataatgtagtttgtttatattttctccgtacaaagaagtac |
34561679 |
T |
|
| Q |
202 |
tcgaattgaattattccgataatggccgatggaagataaggaatcg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34561680 |
tcgaattgaattattccgataatggccgatggaagataaggaatcg |
34561725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 34561486 - 34561528
Alignment:
| Q |
1 |
tgtcactccagatgttccttttcaaacccttgatcttcaggta |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34561486 |
tgtcactccagatgttccttttcaaacccttgatcttcaggta |
34561528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University