View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15252_low_3 (Length: 388)
Name: NF15252_low_3
Description: NF15252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15252_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 18 - 370
Target Start/End: Original strand, 6878570 - 6878922
Alignment:
| Q |
18 |
ccatgcgcccgcgacagttggagaggacgcacgtgaggccttatacgagatgctaccgggcagattaagaatgaaggtaaaggcgaagctaaggggacgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878570 |
ccatgcgcccgcgacagttggagaggacgcacgtgaggccttatacgagatgctaccgggaagattaagaatgaaggtaaaggcgaagctaaggggacgg |
6878669 |
T |
|
| Q |
118 |
tgggcgaaagagggagacgaaggaaatgacgggcactcactggccgaagggtggcgggaggcggtggaggagctaatggaatggctgtctccggtggcgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878670 |
tgggcgaaagagggagacgaaggaaatgacgggcactcactggccgaagggtggcgggaggcggtggaggagctaatggaatggctgtctccggtggcgc |
6878769 |
T |
|
| Q |
218 |
atgacacagtccggtggcatggggaaaggcatttggagaagacaagatttgagacaaagcctacggcaatgcttctgcagacattgcattactctgattt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878770 |
atgacacagtccggtggcatggggaaaggcatttggagaagacaagattcgagacaaagcctacggcaatgcttctgcagacattgcattactctgattt |
6878869 |
T |
|
| Q |
318 |
ggagaaggcagagactgccatagtggaagtgttggttggtttgagttgtgtat |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878870 |
ggagaaggcagagactgccatagtggaagtgttggttggtttgagttgtgtat |
6878922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University